When we hear the word “genome” or “DNA”, most people think of something like this:
CTACGTACGTCGTATTGCAGTCTACTGAC [and so on…]
In other words, a linear representation of the DNA molecule. However, genomes of eukaryotic organisms are not linear; they are folded into intricate and interesting three-dimensional (3D) structures looking more like this:
In the figure above, which shows a computer-generated bioinformatics model of the human genome, each chromosome is shown in a separate color. The nucleus model (in light gray) is cut in half to give an indication of its size. Similar models can be generated for any organism for which Hi-C data is available. More importantly, with such models at hand we can pinpoint the 3D-positions of all genes (and other interesting regions) inside the nucleus of the organism we are studying. This opens up for entirely new ways to study genomes computationally!
A quick explanation of Hi-C can be seen on youtube here.
Examples of master projects:
The master projects in the Paulsen group are entirely computational. You will work with bioinformatics tools to study genomes in new and exciting ways. Before starting on a master project, we will discuss and customize a project according to your background and interests.
Examples of master project are:
- Develop a 3D model of a species of your choice! Pick any species/organism from the DNA zoo: https://www.dnazoo.org/. Supervised by us, you will apply available computational tools to reconstruct the 3D genome structure of the selected organism from the data. The resulting 3D genome model can be further annotated, analyzed and described by placing genes and other elements in the 3D model. Essentially, you will be the first to literally see and describe how the 3D genome looks like in your selected species!
- Analyze how the 3D genome is disorganized in cancers. You will be working with cancer Hi-C data (including breast cancer, lung cancer, skin cancer, and others) to study how Hi-C data can be used to detect mutations and structural variations on chromosomes in 3D-space. These alterations are crucial for understanding how cancer is formed, and can be useful for new cancer treatments in the future.
- Mathematical representations of Hi-C data. If you like mathematics and theory development, this is the project for you. Supervised by us, you will be developing new way to think about 3D genomes. Data can be represented using graphs and hyper-graphs, and new mathematical and computational analyses can emerge from such a representatiosn. This may sound a bit “fussy”, but we have some concrete ideas where this can truly revolutionize how we think about genomes in the future.
- Visualization of genomes. How do we visualize genomic data? What are the basic building blocks for effectively communicating our results in genome science? In this project, you will think about and develop frameworks for visualizing data in new ways.
- Any other project related to genomes in space and time. We are always open to discussing new and exciting ideas for projects together with you.
We are looking for:
Students need to be interested in bioinformatics and programming, but different skill profiles are possible:
- Profile 1: You have knowledge of programming (python, R, command line tools). Essentially what you have had during the bachelor and master courses. You found programming and scripting to be very interesting and fun, you mastered it well, and would like to do more of it. In this case, you will be able to do a more data-driven project with programming components in it.
- Profile 2: You know more programming than what you learned during your studies, or you have a computational background. In this case, you will be able to do a more programming-oriented Master’s project.
Who are we:
The Paulsen group consists of PhD-students, postdocs and master students all working on different aspects of 3D genome organization. As a master student with us, you will be embedded within this environment to learn as much as possible. We are at a high international level with prior publications top journals. Our group has weekly meetings where we present results, discuss interesting recent papers, and give feedback to one another. We are looking forward to welcoming you as a master student in our group!